| Select |
Product |
Note |
CZRC
Catalog ID |
|
|
If you need this mutant line, please contact Dr. Kim, Cheol-Hee at the Kim Lab to obtain a further MTA. Thank you! |
CZ185 |
|
|
visual perception decreased process quality; retinal cone cell photoreceptor outer segment increased length; retinal rod cell degeneration |
CZ186 |
|
|
Between 216 bp to 224 bp of the wild-type trim47 coding sequence, GATGTGG, is deleted. The mutated trim47 codes for a truncated protein containing 195 aa, of which 479 aa are identical to wildtype trim47. |
CZ187 |
|
|
Between 643 bp to 651 bp of the wild-type namptb coding sequence, ACCGTGG, is deleted. The mutated namptb codes for a truncated protein containing 495 aa, of which 498 aa are identical to wildtype namptb. |
CZ188 |
|
|
Between 215 bp to 221 bp of the wild-type trim47 coding sequence, TGATG, is deleted. The mutated trim47 codes for a truncated protein containing 78 aa, of which 479 aa are identical to wildtype trim47. |
CZ189 |
|
|
644 bp to 651 bp of the wildtype namptb coding sequence, TGG, is mutated into ACAGCCTACT. The mutated namptb codes for a truncated protein containing 266 aa, of which 498 aa are identical to wildtype namptb |
CZ190 |
|
|
Between 568 bp to 569 bp of the wild-type pde6c coding sequence, CA, is inserted. The mutated pde6c codes for a truncated protein containing 193 aa, 189 aa of which are identical to wildtype pde6c.Further MTA needed from the Fish Developmental Biotechnology Lab. |
CZ191 |
|
|
Between 566 bp to 567 bp of the wild-type pde6c coding sequence, GGCAATAAACAATAAACAAACAATAAACAATAAACAATAAACAATAAACAA, is inserted. The mutated pde6c codes for a truncated protein containing 201 aa, 188 aa of which are identical to wildtype pde6c. Further MTA needed from the Fish Developmental Biotechnology Lab. |
CZ192 |
|
|
Between 568 bp to 569 bp of the wild-type pde6c coding sequence, CAATCAA, is inserted. The mutated pde6c codes for a truncated protein containing 207 aa, 189 aa of which are identical to wildtype pde6c. Further MTA needed from the Fish Developmental Biotechnology Lab. |
CZ193 |
|
|
Between 874 bp to 877 bp of the wild-type rusc2 coding sequence, TGGA, is mutated into ACCAAGTT. The mutated rusc2 codes for a truncated protein containing 296 aa, 291 aa of which are identical to wildtype rusc2. Further MTA needed from the Fish Developmental Biotechnology Lab. |
CZ194 |
